Primers

BGH REV
5'-AACTAGAAGGCACAGTCGAGG-3'

T7 TERM-1
5'-CAAAAAACCCCTCAAGACCC-3'

M13 R
5'-AGCGGATAACAATTTCACACAGGA-3'

-40 M13 F
5'-GTTTTCCCAGTCACGACGTTGTA-3'

T3
5'-CAATTAACCCTCACTAAAGGG-3'

SP6
5'-CTAGCATTTAGGTGACACTATAG-3'

pENTR 1A-1
5'-AGTTAGTTACTTAAGCTCGGG-3'

pENTR 1A-a1
5'-CAGAGATTTTGAGACACGGG-3'

pCEP4
5'-AGAGCTCGTTTAGTGAACCG-3'

pGEX 5' new
5'-TATATAGCATGGCCTTTGCAGGG-3'

SCT3
5'-CCATTATTATCATGACATTAACCT-3'

T7 TERM
5'-GCTAGTTATTGCTCAGCG-3'

T7 PROMOTER
5'-TAATACGACTCACTATAGGG-3'

EBV REV
5'-GTGGTTTGTCCAAACTGATC-3'

T7 HI TEMP.
5'-TTGTAATACGACTCACTATAGG-3'

M13 REVERSE PENTR
5'CAGGAAACAGCTATGAC-3'

M13 FORWARD pENTER
5'GACGTGGTAAAACGACGGCCAG'3'

V5REV
5'-ACCGAGGAGAGGGTTAGGGAT-3'

3AOX1
5'GCAAATGGCATTCTGACATCC-3'

KS PRIMER
5'TCGAGGTCGACGGTATC-3'

SK PRIMER
5'CGCTCTAGAACTAGTGGATC-3'

SUPERCOS WALKINS
SC4- for
GGGGTTCCGCGCACATTTCCCCGAA

SC5
TATCGCGATGATAAGCGG

5'PGAP
5'-TTTTGGTTTCTCCTGACCC

T(20)V
5'-TTTTTTTTTTTTTTTTTTTTV-3'

T7
5'AATACGACTCACTATAGGG-3'

Latest News

Octorber 13, 2010
Coming Soon